Gene Cry1C And Under Species Bacillus Thuringiensis Subsp. Aizawai

1.1.11. Gene cry1C and under the species Bacillus thuringiensis subsp . aizawai

Gene cry1C

The cry1C gene is about 3 kb in size where the conserved fragment encoding the toxin is 288bp in size. The cry1C gene encodes a toxin crystal protein with a molecular mass of about 130kDa. The subspecies B.thuringiensis subsp. aizawa i has the ability to produce rhombohedral crystals containing the cry1C gene . Up to now, there have been over 16 genes belonging to the c y1C subgroup that have been cloned and published on the Crichmore database, the latest of which is the cry1CAa14 gene .

Maybe you are interested!

In studying the ability to organize receptors on insect intestinal cell membranes, region 2 of Cry1C toxin is able to bind all 3 types of receptors with different molecular weights.

Under the species Bta

Bta is one of 82 subspecies of B. thuringiensis , belonging to serotype 7 according to the taxonomic key of Bonnefoi et al. Barjac, 1963. Among B. thuringiensis strains isolated in Vietnam, up to 15% are Bta [5,10].

Bta forms insecticidal crystals during the steady-phase growth cycle. Crystals are mainly rhombic. Under the species Bta carries genes encoding many crystal proteins of the Cry 1 group such as Cry 1C, Cry 1D, Cry 1Aa, Cry 1Ab. Thus Bta is one of the most commonly used subspecies in Bt preparations . Bta has the ability to kill many important pests such as silkworm ( Plutella Xylustella ), CL, ICW, green worm, tomato fruit worm, borer. Bta is still effective in killing pests in areas that have shown resistance to Btk toxin [38].

On the market today, XenTari preparations made from Bta are widely used and have activity to kill important pests that are resistant to chemical pesticides such as worms, green worms [10].

1.2. An outline of scaled insects

1.2.1. Scale-winged insects

Lepidoptera is a large order in entomology, which includes butterflies and moths. The order of scales includes more than 180,000 species in 128 phylums and 47 families. Of the more than 180,000 species described so far, they can be found almost everywhere. About 11,300 species are found from North America and 10,000 species are found in Australia. Scallops are found in most habitats, but they are almost always found in higher vegetation, especially angiosperms [3].

Like all insects, the scaly wing has an exoskeleton and is divided into three parts: the head, thorax, and abdomen. They have 3 pairs of legs on the thorax, two large compound eyes, and an elongated mouth called a proboscis. The larvae have a soft body, a well-developed head, and up to 11 pairs of legs (usually 8 pairs). They usually lay eggs on host species, the number of eggs varies from a few to a few thousand. After the eggs hatch into larvae, the larvae feed on all parts of the plant. Larvae develop rapidly with several generations per year, however, some species have a development period of up to 3 years. Scallops cause serious damage to agriculture, mainly when they are larval age, they bore the stem, eat the leaves and damage the tree, leading to the death of the tree: corn insect pests, vegetable silkworms, and fruit and vegetable borers.

1.2.2. Experimental Insects

Silkworm

Silkworm (Plutella xylostella) belongs to the order Lepidoptera, family Plutellidae, also known as flying caterpillars, swing worms, parachute caterpillars.

Silkworms destroy most types of leaves: kohlrabi, cabbage, soybeans. They have been evaluated as a serious and resistant pest in many studies. Silkworm is widely distributed, as of 1982, up to 128 countries and territories have announced the presence of this worm. High reproductive silkworm,

Short life cycle, rapid drug resistance. The annual loss caused by silkworm is about 30-50% of yield, the cost of prevention accounts for 20-40% of the total investment cost, especially on cabbage [3].

Biological and morphological properties of silkworms

Depending on the temperature, silkworms have different growth cycles, at a temperature of 20 -30 0 C, their life cycle is 20 -30 days, at a temperature of 15 - 20 0 C, the life cycle is 40 days. This is a species that metamorphoses through 4 phases: Egg – larva – pupa – adult (Figure 1.5).

Egg period 2-3 days, oval, light yellow 4-5mm long, 0.3-0.5mm in diameter. Eggs are laid sporadically on the underside of leaves, near the main veins and hatch within 3–4 days. Larval period 8-10 days, tubular, light green, 8-10mm long, head is light brown, hairy on nodes. Young caterpillars develop over 4 years old. Age 1: Body milky white, about 0.8 mm long. By the end of this age, the body is 1.2-1.5 mm long. Age 1 develops from 2-4 days. Age 2: The worms begin to turn bluish but still opaque. The depth is 1.5-3.5 mm long. At the age of 2, the worm develops in 1-3 days. Age 3: The worm is bright green, 3.5-5.5 mm long and develops from 1-3 days. Age 4: The worm has a darker green color, the body size is from 5.5-9 mm, develops from 1-4 days. At this stage, the worm is pale green, tubular with many nodes, each with many small hairs. The head is yellowish-brown with hard plates, on which there are light brown dots. On the hard part of the dorsal thorax there are dots arranged in a U shape.

The pupal stage is 3-4 days, the pupa is green or pale yellow, 6-7mm long, wrapped in a thin white spongy cocoons under the leaf surface.

Adult period 5-7 days, adult caterpillars (butterflies) body length are 6-10mm, average wingspan is 15mm, wings are grayish-brown, the forewing edge has three triangular markings of light brown to white and small, long fine feathers, when perched close to the body. Butterflies rarely fly but often move with the wind, active from dusk to midnight, each female lays 50-400 eggs. Eggs are laid separately on the surface

face of the leaf. Young caterpillars are 4 years old, newly hatched caterpillars dig into leaves to form grooves, older ones are on the underside of leaves [3].

Harmful characteristics

Figure 1.5. Silkworm life cycle [3]

Silkworms commonly damage cruciferous crops. Young caterpillars eat leaves, when the density is high, it will puncture the leaves, making the leaves wiry, damaged leaves lose the ability to photosynthesize and retain water, the plant grows poorly and dies. Silkworm destroys the entire leaf of the plant, especially important when the caterpillar attacks at the new stage of planting, the young caterpillars hatch to form grooves, at the old age the caterpillar eats the entire leaf cuticle and will be perforated. Silkworms cause damage all year round and most damage is in the winter-spring crop.

Figure 1.6. Insect-infested cabbage vegetables [3]

Studies have shown that silkworms are serious pests with high resistance to pesticides. In the body of silkworms, there is an enzyme that can break down drugs into non-toxic substances, which is the microsonal enzyme system. When the worm's body is exposed to toxic chemicals, the micro enzyme system is stimulated to increase its activity by 100-200 times [3].

Smooth skin worm

The blue-skinned caterpillar (Spodoptera exigua) has the scientific name Spodoptera exigua Hubner, belongs to the family Noctuidae (Night-Mr), Lepidoptera (order Scales).

In Vietnam, especially in the Mekong Delta, since 1981 the caterpillars have been the main pests of soybeans, green beans, onions, peppers and some other short-term crops. The life cycle of the caterpillar is about 30 to 40 days, divided into 3 stages:

Adult stage : The butterfly is a moth, grayish-white, with a body length of 7-10 mm, a wingspan of 20-25 mm. Gray head, hairy gills, large compound eyes, black, thread-shaped antennae, 5-6 mm long. The chest is reddish brown, covered with an ash-gray powder with a metallic sheen. Fore wings grayish brown, elongated, triangular, wing angle slightly oval, with many veins. The lifespan of the butterfly is 5-10 days and a female butterfly can lay 300-400 eggs within 3-5 days.

Eggs are spherical, 0.4-0.5mm in diameter, green to pale yellow when newly laid, then turn milky white, about to hatch with a black dot on the eggshell, which is the eye of the worm. Eggs are laid in nests, covered with ivory white hairs. The incubation period for eggs is 2-4 days.

The larval stage: The caterpillar is from 5-6 years old, develops in 10-19 days. The dorsal surface of the worm is green and smooth, so it is also called "Golden Green Worm" to distinguish it from the Blue Worm ( Heliothis armigera ). Details in each age depth are as follows:

Age 1: deep body with green or yellow-green color, glossy black head, hairy, pale yellow belly, body length from 1.2-1.5mm, usually the head is larger than the body width and the stripes on the body are not obvious. The development time of worms at this age is from 2-5 days.

From the age of 2, the color on the body begins to show signs of leakage. The abdomen is yellow-green, the segments on the body are gradually differentiated. Deep body has 3 translucent white stripes, one stripe in the middle of the back and 2 stripes on the sides of the body, all 3 stripes running from the first to the last segment of the abdomen. At this age, the worm has an average body size of 0.45x3.7mm. The development time of the 2nd worm is 2-4 days.

At the age of 3, the deep molt is yellow-green at first, then turns green. Head pale yellow, glossy; still have lots of feathers. The dots on the body become smaller, the hairs are shorter. The development time of worms at this age is from 2-3 days.

After hatching, the worms live around the eggs, eating the chlorophyll of the leaves into small holes, leaving the white cuticle. At the end of age 1, the worm begins to disperse to neighboring leaves. The 2-year-old larvae feed on leaves into small holes and have the habit of releasing silk to drop to the ground when passive. At the age of 3, the caterpillars eat the most, biting the leaves into large holes; Worms also hang on the inflorescences of soybean plants and feed on newly sprouted petals. In fields with high density, the caterpillars feed on leaves that are still intact with the main veins and stalks and even young fruit [3].

Pupation stage: Lasts 7–10 days, the caterpillar usually pupates in the soil or clump of hay.

Figure 1.7. The life cycle of the blue-skinned caterpillar [3]

Chapter 2. RESEARCH MATERIALS AND METHODS

2.1. Material

2.1.1. Biology products

150 strains of Bt isolated from soil samples in Thai Nguyen, unclassified and crystal shaped, provided by the Department of Microbial Genetics.

E. coli DH5α was obtained from the Department of Microbial Genetics, Institute of Biotechnology.

Silkworm ( Plutella xylostella) and blue-skinned caterpillar ( Spodoptera exigua ) 2 years old provided by the Plant Protection Institute.

Primer pairs used to amplify the cry1C gene were provided by the Department of Microbial Genetics.

- Cry1C . gene-specific primer pairs

TYIC 5' – CAACCCTCTATTTGGTGCAGGTTC 3'

TYIUNI 5'- TCACTGAGTCGCTTCGCATGTTTGACTTTCTC 3'

- Primer pair M13

Reverse M13: 5'- CAGGAAACAGCTATG – 3' Forward M13: 3'- GTAAAACGACGGCCA – 5'

Plasmid cloning vector: pGEM-T Easy

Taq polymerase, restriction enzyme ( Eco RI), ligase... of Invitrogen, Fermentas.

2.1.2. Chemicals and equipment

Chemistry:

- Chemicals used in isolating and culturing Bt : agar, meat extract, yeast extract, peptone, NaCl....

- Chemical used to stain spores and crystals: fuchsin base

- Chemicals used in electrophoresis: agarose, SDS, Tris-base, TAE.

- Chemicals used in PCR reaction: dNTPs, Taq polymerase, buffer, deionized water...

Device:

Research equipments include: Centrifuge (Fresco, Germany), PCR machine (PTC-100, USA), vortex machine (IKA, Germany), shaker (Gerharat, Germany), gel scanner (Vilber Lourmat, Germany), gel scanner (Gen Doc), microscope (Olympus, Japan), deep refrigerator (Frigo, Denmark).

In addition, we also use a number of other tools for the research process such as: petri dishes, triangle flasks, pipettes.

Environment:

Types of media used during the experiment:

 MPA-MT1 medium (g/l)

Agar: 20g Pepton: 10g Distilled water: 1l

NaCl: 5g Meat broth: 4g pH: 7

 MPB-MT2 medium (g/l)

Pepton: 10g Distilled water: 1l pH: 7 NaCl: 5g Meat broth: 4g

 Craige-MT3 medium (g/l)

Bacto agar: 8g Pepton: 10g Distilled water: 1l

NaCl: 5g Meat broth: 4g pH: 7

 LB-MT4 medium (g/l)